Skip to main content

Table 1 Primers used in this work (F: forward primer, R: reverse primer)

From: In vivo functional expression of a screened P. aeruginosa chaperone-dependent lipase in E. coli

Primers Sequence (5’-3’) Source
A-F GGATCCATGAAGAAGAAGTCTCTGCT Amplification of lipA, BamHI site
A-R AAGCTTCTACAGGCTGGCGTTCTT Amplification of lipA, HindIII site
B-F GGGCATATGGTGAAGAAAATCCTCCTG Amplification of lipB, NdeI site
B-R CTCGAGTCAGCGCTGCTCGGCCT Amplification of lipB, XhoI site
AB-F CCTTGGATCCATGAAGAAGAAGTCTCTGCTCC Amplification of lipAB, BamHI site
AB-R CCTTAAGCTTCAGCTGCTCGGCCTGGCGCAT Amplification of lipAB, HindIII site