Skip to main content

Table 2 DNA sequences of the oligonucleotides used in padlocks

From: Comparison and transfer testing of multiplex ligation detection methods for GM plants

Name Type T1, 5' target (5'-3') cZIP sequence (5'-3') T2, 3' target (5'-3') Size (nt)
TC1507 event CGCGGTTTGTGATATCGTTAACCATTACATTGAGACGTCTAC ATGATGTGCAAAGTGCCGTC CTTTCGTTCTTGTGTTC 126
pat element CAACCACAGACTTAAAACCTTGCGCCTCCATAGAC ACGCTAATGACGGCAGTGCA GGAAGGCCTATAACAG 118
cry1F element GAAACGTGTAAGGGACAGGGAGATGTCTAACGGCAATC ATTTGACGAACGTATGCCGC ACAAACTCAGACAACAG 122
cry1Ab element CAGGTTGGTGCACTTGGTGAGGGGGATCTGGGTGATTTGG ACATCCTGGACACGAGTGAC GGTGCCGCTGCC 119
cp4-epsps element GGCCTTGCCCGTATTGATGACGTCCTCGCC ATTAACTCGACTGCCGCGTG CCCATGGCCTGCAT 111
barstar element GCCTCCATTCCAAAACGAGCGGGTACTCCA TCCTCTCGTTGGATGTGAGC CTTGCTTTGTTCAAACT 114
Bt11 construct ATCTTCGCTAGAGTAAGGGTTTCTTATATGCTCAACACATGAGCG GAATGCGGTTCAACAGTCTT GCGAGGTGAAGAGG 126
maize (hmg) species CACACAAACGCACGCGTAAAACAATTAATCAGCACGAG CTGCGGTGTCAGTGATCTCT GCCTTGTCCTACAATC 121
maize (zein)   CTGTGGCATCATCACTGGCATCGT GTACTACATTCGTGCGATGG TTAGGCGTCATCAT 124
rice species CCATTGCTGTCTCTGCAAGCTCACGCGC ATGCAGCGTAGGTATCGACT CGGCAGCAACTCTCA 110