- Research article
- Open Access
Domain-swapping of mesophilic xylanase with hyper-thermophilic glucanase
https://doi.org/10.1186/1472-6750-12-28
© Liu et al.; licensee BioMed Central Ltd. 2012
- Received: 2 January 2012
- Accepted: 7 June 2012
- Published: 7 June 2012
Abstract
Background
Domain fusion is limited at enzyme one terminus. The issue was explored by swapping a mesophilic Aspergillus niger GH11 xylanase (Xyn) with a hyper-thermophilic Thermotoga maritima glucanase (Glu) to construct two chimeras, Xyn-Glu and Glu-Xyn, with an intention to create thermostable xylanase containing glucanase activity.
Results
When expressed in E. coli BL21(DE3), the two chimeras exhibited bi-functional activities of xylanase and glucanase. The Xyn-Glu Xyn moiety had optimal reaction temperature (Topt) at 50 °C and thermal in-activation half-life (t1/2) at 50 °C for 47.6 min, compared to 47 °C and 17.6 min for the Xyn. The Glu-Xyn Xyn moiety had equivalent Topt to and shorter t1/2 (5.2 min) than the Xyn. Both chimera Glu moieties were more thermostable than the Glu, and the three enzyme Topt values were higher than 96 °C. The Glu-Xyn Glu moiety optimal pH was 5.8, compared to 3.8 for the Xyn-Glu Glu moiety and the Glu. Both chimera two moieties cooperated with each other in degrading substrates.
Conclusions
Domain-swapping created different effects on each moiety properties. Fusing the Glu domain at C-terminus increased the xylanase thermostability, but fusing the Glu domain at N-terminus decreased the xylanase thermostability. Fusing the Xyn domain at either terminus increased the glucanase thermostability, and fusing the Xyn domain at C-terminus shifted the glucanase pH property 2 units higher towards alkaline environments. Fusing a domain at C-terminus contributes more to enzyme catalytic activity; whereas, fusing a bigger domain at N-terminus disturbs enzyme substrate binding affinity.
Keywords
- Xylanase
- Glucanase
- Domain-swapping
- Fusing
Background
Enzyme is important in biomass conversion and renewable energy production. However, biotechnological condition demands for thermostable enzymes. Thermostability can be enhanced by fusing proper protein fragments, such as, the non-homologous fragments [1], the thermophilic xylanase homologous N-terminus [2, 3], the hyper-thermophilic carbohydrate binding-module [4], and the Pseudoalteromonas arctica esterase OsmC domain [5]. Two catalytic domains, such as, xylanase and glucanase, can also be combined to create bi-functional chimeras [6–8]. However, the domain fusions were limited at xylanase one terminus. When fused at the other terminus, the Clostridium thermocellum xylanase and Thermotoga maritima glucanase activities were damaged [7–9]. Thereby, domains need to be swapped with each other in fusion investigation.
Construction of the chimeras. The domains Xyn and Glu were connected by overlapping-extension PCR. The genes xyn and glu were amplified using p1/p2 and p3/p4, respectively, and the xyn-glu was created using p1/p4 (Upper). Thereafter, the genes glu and xyn were amplified using p5/p6 and p7/p8, respectively. The glu-xyn was created using p5/p8. The wild Xyn and Glu were amplified using p1/p8 and p5/p4, respectively. The fusion genes appear on the gel as discrete bands at ~ 1.4 kb, with molecular masses of approximately the sum of the contributing gene fragments (Middle). The two chimeras appear on the SDS-PAGE gel as discrete bands at ~ 53 kDa, with molecular masses of approximately the sum of the Xyn, linker peptide, and Glu (Lower). Linker: linker-peptide, M: marker of DNA and protein.
Results and discussion
Construction of chimeras
Enzyme property of the chimeras
Enzyme | Xyn Activity | Glu Activity | Physical feature | |||||
---|---|---|---|---|---|---|---|---|
t1/2-50 °C (min) | pHopt/Topt(°C) | Km(mg/ml)/Kcat(s-1) | t1/2-95 °C (min) | pHopt/Topt(°C) | Km(mg/ml)/Kcat(s-1) | MM(kDa) Apparent/Theoretical | Number of residues/pI | |
Xyn-Glu | 47.6 | 3.8/50 | 10.2/118.9 | > 99.8 | 3.8/≥ 96 | 5.9/3.4 | 53/ 53.2 | 465/4.5 |
Glu-Xyn | 5.2 | 3.8/47 | 44.2/50.2 | 99.8 | 5.8/≥ 96 | 1.88/15.9 | 53/53.2 | 467/4.5 |
Xyn | 17.6 | 3.8/47 | 12.3/49.2 | 25/ 21.1 | 185/4.5 | |||
Glu | 96.2 | 3.8/≥ 96 | 1.87/2.6 | 29/ 30.9 | 258/4.78 |
Properties of the chimeras
Optimal pH of both moieties. The Glu-Xyn Xyn moiety (■) has equivalent pHopt to the Xyn-Glu Xyn moiety (●) and the Xyn (▲) (Left). The Glu-Xyn Glu moiety has pHopt at 5.8, 2 units higher than the Xyn-Glu Glu moiety and the Glu (▲) (Right).
Thermal property of Xyn moiety. The Xyn-Glu Xyn moiety (●) has 3 °C higher Topt than the Glu-Xyn Xyn moiety (■), and its Topt equals to that of the Xyn (▲) (A). The residual xylanase activity was assayed after incubation at 50 °C at 10-min intervals from 0 – 30 min (B). The Xyn-Glu Xyn moiety t1/2 was 47.6 min, 2.7-fold longer than the Glu-Xyn Xyn moiety (5.2 min) and the Xyn (17.6 min).
Thermal property of Glu moiety. Both chimera Glu moiety Topt values were higher than 96 °C, similar to the wild Glu (▲) (A). The residual glucanase activity was assayed after incubation at 95 °C at 20-min intervals from 0 – 60 min (B). The Glu-Xyn Glu moiety (■) t1/2 was 99.8 min, shorter than the Xyn-Glu Glu moiety (●) and longer than the Glu (96.2 min).
When the kinetics were determined, the xylanase catalytic efficiencies (Kcat) toward birch-wood xylan increased in the order Xyn < Glu-Xyn < Xyn-Glu. The substrate-binding affinities (Km) for birch-wood xylan increased in the order Glu-Xyn < Xyn < Xyn-Glu (Table 1). Fusing the Glu domain at either terminus cooperated with the xylanase to degrade substrate; however, fusing the Glu domain at N-terminus interfered with the xylanase substrate-binding affinity. In contrast, the glucanase catalytic efficiencies (Kcat) toward carboxymethyl cellulose sodium (CMC) increased in the order Glu < Xyn-Glu < Glu-Xyn. The substrate-binding affinities (Km) for CMC increased in the order Xyn-Glu < Glu = Glu-Xyn (Table 1). Fusing the Xyn domain at either terminus cooperated with the glucanase to degrade substrate; however, fusing the Xyn domain at N-terminus interfered with the glucanase substrate-binding affinity. Thus, a domain, especially, a bigger one, is better fused at C-terminus for enzyme getting higher activity.
The Xyn-Glu Xyn moiety Topt was 3 °C higher than the Xyn. This is consistent with the Xyn Topt 3 °C increase after fusing the hyper-thermophilic carbohydrate-binding module [4]. Previous domains were mainly fused at enzyme one terminus. For example, the Bacillus subtilis xylanase was fused at the Bacillus amyloliquefaciens glucanase C-terminus [6]. The T. maritima xylanase was fused at the T. maritima glucanase C-terminus [8]. The T. maritima β-glucosidase was fused at the T. maritima cellulase C-terminus [9]. When the domains were fused at the other terminus, the chimeras lost both moiety activities [6, 8]. There are so many xylanase domains fused at glucanase C-terminus. The situation probably indicates that xylanase locates naturally at downstream of glucanase. It is probably a trace of natural evolution, because the site location order is shown in the glucanase-xylanase bi-functional protein selected from meta-genome library [13]. The domain-swapping created different effects on each moiety properties. The N-terminal Glu domain decreased the xylanase thermostability; however, the C-terminal Glu domain increased the xylanase thermostability. The Glu has 258 residues, ~ 1.4-times bigger than the 185 residue Xyn. Probably, the C-terminal Glu protects the Xyn from thermal inactivation; whereas, the N-terminal Glu interferes with the Xyn folding and confirmation-forming, therefore, interferes with its thermostability. In contrast, fusing the Xyn at either terminus, especially, at N-terminus, increased the glucanase thermostability. In addition, fusing the Xyn at C-terminus shifted the glucanase pHopt 2 units higher to alkaline environment. The result probably reflects that glucanase cooperates with other catalytic domains on both sides, because two glucanases, CelA and CelB, are shown connecting together in the T. maritima genome (EMBL-Bank: Z69341.1) [14].
Each domain has a natural conformation to perform catalytic activity. Therefore, each domain needs a necessary space to form to an active conformation [4, 17–19], that is the reason why a suitable linker-peptide is so important. The decreased chimera Topt values in previous investigations are attributed to linker-peptide interference. For example, fusing the B. amyloliquefaciens β-glucanase decreased the B. subtilis xylanase Topt value and thermostability [6]. Fusing the T. maritima glucanase also decreased the xylanase Topt value. When the domains were fused at other terminus, many enzyme activities were damaged [6, 8]. The phenomenon is attributed to lack of linker-peptide. For example, the glucanases lost activities when fused at the other terminus [8, 9]. To exclude the linker-peptide disturbance, we used the natural 22 residue linker-peptide to connect the Glu and Xyn. In addition, boundary determination is important for each domain to have complete residues. Only a domain has complete residues, can it form to an active confirmation. In the meantime, we have to eliminate the extra residues encoded by unnecessary endo-nuclease sites in expression vectors. Otherwise, the extra residues would disturb enzyme properties [20]. Thereby, NdeI and XhoI were used to delete the unnecessary endo-nuclease sites within the pET20b(+).
Conclusions
Through the natural 22 residue linker-peptide, the mesophilic A. niger Xyn was fused and swapped with the hyper-thermophilic T. maritima Glu. After expression in E. coli, both chimeras exhibited bi-functional activities of xylanase and glucanase. Especially, the Xyn-Glu Xyn moiety had 3 °C higher Topt and 2.7-times higher thermostability than the Xyn. In addition to the synergistic glucanase activity, the fungal xylanase was enhanced thermostability. The domain-swapping created different effects on each moiety. Fusing the Glu domain at C-terminus increased the xylanase thermostability, but fusing the Glu domain at N-terminus decreased its thermostability. Fusing the Xyn domain at either terminus increased the glucanase thermostabilities, and fusing the Xyn domain at C-terminus shifted the glucanase pH property 2 units higher towards alkaline environments. From the domain-swapping investigation, we can infer that a domain, especially a larger one, can only be fused at C-terminus to increase enzyme catalytic efficiency.
Methods
Materials and reagents
The A. niger Xyn gene (GenBank: EU375728), which encodes a 185 residue (M1-S185) mature xylanase, was cloned into pET20b(+) (Novagen, Shanghai, China). The T. maritima Glu gene (GenBank: Z69341), which encodes a 258 residue (M1-E258) mature glucanase, was cloned into pET20b(+) [15]. The 22 residue linker-peptide (P692-G713), which was selected from the T. maritima xylanase A (GenBank: Z46264), was used to connect the two domains [4] (Figure 1). Molecular reagents including Pfu polymerase, NdeI and XhoI, T4 DNA ligase, and DNA and protein marker were purchased from Takara Inc (Dalian, China).
Construction of chimeras
Through the linker-peptide, the two domains were fused together by overlapping-extension PCR. The standard PCR was carried out using 16.5 μg of pET20b-xyn or pET20b-glu, 1.0 μl of each of two related primers, 5 U of Pfu polymerase, 4.0 μmol of dNTPs, and 1 × polymerase buffer with the following thermal cycling: 4 min denaturation at 95 °C, followed by 30 cycles of 1 min denaturation at 94 °C, 1 min annealing at 33 °C, and 1 min extension at 72 °C. The reaction was completed with a 10 min extension at 72 °C, unless described otherwise.
Primers used to construct chimeras
primer | sequence |
---|---|
p1 | GGAATTCCATATGAGTGCCGGTATC |
p2 | CCAACGCTCGTCAGGTACGAGTC |
p3 | GACTCGTACCTGACGAGCGTTGG |
p4 | CCAAATTACTCGAGAACTTCGACAGAG |
p5 | GAATTCCATATGACGAGCGTTGG |
p6 | GTTGATACCGGCAGTCAGGTACGAGTCATCC |
p7 | GGATGACTCGTACCTGAGTGCCGGTATCAAC |
p8 | ATTACTCGAGAGAGGAGATCGTGAC |
Following PCR amplification, the genes were cloned into pET20b(+) plasmids that had been digested with NdeI/XhoI to delete the redundant endo-nuclease sites. The recombinant plasmids were transformed E. coli BL21(DE3) competent cells, then extracted and sequenced with an ABI 3730 automated DNA sequencer to confirm gene accuracy (Invitrogen Biotechnology, Shanghai, China). Accurately transformed plasmids were grown and induced to produce enzymes according to standard protocols [4]. A C-terminal His6 tag was included in the chimera sequences to allow the proteins to be purified with Co2+-binding resin (Amersham Bioscience). Active fractions were pooled and further purified using sephadex G-25. The enzymes were detected using 12 % polyacrylamide SDS-PAGE, stained with Coomassie brilliant G-250. Protein concentrations were measured according to the Lowry method.
Enzyme properties of the chimeras
Each moiety of both chimeras was assayed in parallel with the Xyn or Glu, respectively. Every data point was determined for three independent reactions, including protein concentration, substrate concentration, optimal reaction temperature (Topt), optimal reaction pH (pHopt), residual activity, etc. The pHopt value was determined from pH 2.6 – 5.0 in imidazole-biphthalate buffers. The Xyn moiety Topt was determined from 44 – 53 °C, and residual activity was assayed after incubation at 50 °C at 10-min intervals from 0 – 40 min. The Glu moiety Topt was determined from 78 to 96 °C, and residual activity was assayed after incubation at 95 °C at 20-min intervals from 0 – 60 min. To indicate thermostability, residual activity was expressed as a ratio relative to the un-incubated enzyme activity, and the thermal in-activation half-life (t1/2) was calculated by fitting the data with the equation y = A * e -kt (Origin, version 8.0).
The kinetics were assayed at Topt and pHopt conditions using birch wood xylans at concentrations from 10 – 40 mg/ml for 5 min (Sigma-Aldrich, Shanghai, China). The kinetics for glucanase were assayed at 85 °C and pHopt conditions using CMC at concentrations from 2.5 – 15 mg/ml for 5 min. The data were fitted with the Hill function to calculate maximal activity (Vmax) and Km (Origin, version 8.0). Xylanase activity was determined toward birch-wood xylan and glucanase activity was determined toward CMC using the dinitrosalicylic acid (DNS) method described previously [4]. One unit of activity (U) was defined as the amount of enzyme that produced 1 μmol xylose or glucose per minute.
Author’s contributions
Liu, L. conceived of the study and participated in its design. Wang, L., Zhang, Z., and Guo, X. carried out the molecular genetic studies. Li, X. and Chen, H. performed the statistical analysis. All authors read and approved the final manuscript.
Declarations
Acknowledgements
This work was supported by Natural Science Foundation of China (30972123) (20971050). The authors are grateful to Ian Riley for his advice on paper writing and the anonymous reviewers for their sincere suggestions of the paper.
Authors’ Affiliations
References
- Bittker JA, Le BV, Liu JM, Liu DR: Directed evolution of protein enzymes using nonhomologous random recombination. Pro Natl. Acad. Sci. USA. 2004, 101: 7011-7016. 10.1073/pnas.0402202101.View ArticleGoogle Scholar
- Sun JY, Liu MQ, Xu YL, Xu ZR, Pan L, Gao H: Improvement of the thermostability and catalytic activity of a mesophilic family 11 xylanase by N-terminus replacement. Protein Expr Purif. 2005, 42: 122-130. 10.1016/j.pep.2005.03.009.View ArticleGoogle Scholar
- Zhang S, Zhang K, Chen X, Chu X, Sun F, Dong Z: Five mutations in N-terminus confer thermostability on mesophilic xylanase. Biochem Biophys Res Commun. 2010, 395: 200-206. 10.1016/j.bbrc.2010.03.159.View ArticleGoogle Scholar
- Liu L, Cheng J, Chen H, Li X, Wang S, Song A, Wang M, Wang B, Shen J: Directed evolution of a mesophilic fungal xylanase by fusion of a thermophilic bacterial carbohydrate-binding module. Process Biochem. 2011, 46: 395-398. 10.1016/j.procbio.2010.07.026.View ArticleGoogle Scholar
- Elleuche S, Piascheck H, Antranikian G: Fusion of the OsmC domain from esterase EstO confers thermostability to the cold-active xylanase Xyn8 from Pseudoalteromonas arctica. Extremophiles. 2011, 15: 311-317. 10.1007/s00792-011-0361-8.View ArticleGoogle Scholar
- Lu P, Feng MG, Li WF, Hu CX: Construction and characterization of a bifunctional fusion enzyme of Bacillus-sourced β-glucanase and xylanase expressed in Escherichia coli. FEMS Microbiol Lett. 2006, 261: 224-230. 10.1111/j.1574-6968.2006.00367.x.View ArticleGoogle Scholar
- An JM, Kim YK, Lim WJ, Hong SY, An CL, Shin EC, Cho KM, Choi BR, Kang JM, Lee SM, Kim HYHD: Evaluation of a novel bifunctional xylanase-cellulase constructed by gene fusion. Enzyme Microb Technol. 2005, 36: 989-995. 10.1016/j.enzmictec.2005.01.030.View ArticleGoogle Scholar
- Hong SY, Lee JS, Cho KM, Math RK, Kim YH, Hong SJ, Cho YU, Kim H, Yun HD: Assembling a novel bifunctional cellulase-xylanase from Thermotoga maritima by end-to-end fusion. Biotechnol Lett. 2006, 28: 1857-1862. 10.1007/s10529-006-9166-8.View ArticleGoogle Scholar
- Hong S, Lee J, Cho K, Math R, Kim Y, Hong S, Cho Y, Cho S, Kim H, Yun H: Construction of the bifunctional enzyme cellulase-β-glucosidase from the hyperthermophilic bacterium Thermotoga maritima. Biotechnol Lett. 2007, 29: 931-936. 10.1007/s10529-007-9334-5.View ArticleGoogle Scholar
- Liebl W, Winterhalter C, Baumeister W, Armbrecht M, Valdez M: Xylanase attachment to the cell wall of the hyperthermophilic bacterium Thermotoga maritima. J Bacteriol. 2008, 190: 1350-1358. 10.1128/JB.01149-07.View ArticleGoogle Scholar
- Ahmed S, Riaz S, Jamil A: Molecular cloning of fungal xylanases: an overview. Appl Microbiol Biotechnol. 2009, 84: 19-35. 10.1007/s00253-009-2079-4.View ArticleGoogle Scholar
- Chen H, Yan X, Liu X, Wang M, Huang H, Jia X, Wang J: Purification and characterization of a novel bifunctional xylanase, XynIII, isolated from Aspergillus niger A-25. J Microb Biot. 2006, 16: 1132-1138.Google Scholar
- Nam KH, Kim SJ, Hwang KY: Crystal structure of CelM2, a bifunctional glucanase-xylanase protein from a metagenome library. Biochem Biophys Res Commun. 2009, 383: 183-186. 10.1016/j.bbrc.2009.03.149.View ArticleGoogle Scholar
- Nelson KE, Clayton RA, Gill SR, Gwinn ML, Dodson RJ, Haft DH, Hickey EK, Peterson JD, Nelson WC, Ketchum KA, McDonald L, Utterback TR, Malek JA, Linher KD, Garrett MM, Stewart AM, Cotton MD, Pratt MS, Phillips CA, Richardson D, Heidelberg J, Sutton GG, Fleischmann RD, Eisen JA, White O, Salzberg SL, Smith HO, Venter JC, Fraser CM: Evidence for lateral gene transfer between Archaea and bacteria from genome sequence of Thermotoga maritima. Nature. 1999, 399 (6734): 323-329. 10.1038/20601.View ArticleGoogle Scholar
- Li X, Shao W: The construction of Thermotoga maritima endoglucanase Cel 1 2B fused with CBD and the characterization of chimeric enzyme. Acta Microbiol Sin. 2006, 46: 726-729.Google Scholar
- Sunna A, Gibbs MD, Bergquist PL: The thermostabilizing domain, XynA, of Caldibacillus cellulovorans xylanase is a xylan binding domain. Biochem J. 2000, 346: 583-586. 10.1042/0264-6021:3460583.View ArticleGoogle Scholar
- Lu P, Feng MG: Bifunctional enhancement of a beta-glucanase-xylanase fusion enzyme by optimization of peptide linkers. Appl Microbiol Biot. 2008, 79: 579-587. 10.1007/s00253-008-1468-4.View ArticleGoogle Scholar
- Fan Z, Werkman JR, Yuan L: Engineering of a multifunctional hemicellulase. Biotechnol Lett. 2009, 31: 751-757. 10.1007/s10529-009-9926-3.View ArticleGoogle Scholar
- Mitra T, Sailakshmi G, Gnanamani A, Thirupathi Kumara Raja S, Thiruselvi T, Mangala Gowri V, Selvaraj N, Ramesh G, Mandala AB: Preparation and characterization of a thermostable and biodegradable biopolymers using natural cross-linker. Int J Biol Macromol. 2011, 48: 276-285. 10.1016/j.ijbiomac.2010.11.011.View ArticleGoogle Scholar
- Liu L, Zhang G, Zhang Z, Wang S, Chen H: Terminal amino-acids disturb Xylanase thermostability and activity. J Biol Chem. 2011, 286: 44710-44715. 10.1074/jbc.M111.269753.View ArticleGoogle Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Comments
View archived comments (1)