Skip to main content

Table 1 Sense (F) and antisense (R) oligonucleotides used for PCR amplifications

From: RNA viral vectors for improved Agrobacterium-mediated transient expression of heterologous proteins in Nicotiana benthamiana cell suspensions and hairy roots

Primer Sequence (5’ – 3’) Hybridization site
AscI_GI_F TA GGCGC GCC ATGGTCCGTCCTGTAGAA 5’ terminus of GUS-intron
GI_NotI_R TT GCGGCCGCAGAGGATCCTCATTGTTT 3’ terminus of GUS-intron
Rep_F GCCTGAGTTTTGTGGTTGG internal to PVX RdRp
GI_R GGATAGTCTGCCAGTTCAGTTCG internal to GUS-intron
GI_XhoI_R CCTA CTCGAGCCTCATTGTTTGCCTCCC 3’ terminus of GUS-intron
PEBVsgPR_F AACTCGGTTTGCTGACCTAC PEBV subgenomic promoter
TRV3UTR_R ACCTAAAACTTCAGACACGG 3’ UTR of TRV RNA-2
AgeI-GI_F TATA ACCGGTCATGGTCCGTCCTGTAGAAACC 5’ terminus of GUS-intron
pEAQ_F AACGTTGTCAGATCGTGCTTCGGCACC 5’ UTR of pEAQ-HT
pEAQ_R CTCCTGTTTAGCAGGTCGTCCCTTCAG 3’ UTR of pEAQ-HT
  1. Sequences added with 5’ extensions are shown in bold with restriction enzyme recognition sites underlined. Initiation codons are italicized. UTR, untranslated region; PEBV, Pea early browning virus; RdRp, RNA-dependent RNA polymerase.