Skip to main content

Table 1 Primers used for RT-PCR

From: Isolation and characterization of Wharton’s jelly-derived multipotent mesenchymal stromal cells obtained from bovine umbilical cord and maintained in a defined serum-free three-dimensional system

Genes Primer sequences (5` to 3`) Size (bp)
Bov- beta actin AGGAAGGAAGGCTGGAAGAG (forward) GAAATCGTCCGTGACATCAA (reverse) 126
POU5F1 ACCCAGGCTGATGTGGGGCTC (forward) TGTGGCTAATTTGCTGCAGGGTG (reverse) 300
ITSN1 ATGCAGTCAAGTTTACCACAG (forward) TGACTGAGGAACAGCCCACTCTGC (reverse) 128