Skip to main content

Table 3 Antimicrobial peptides expressed in this research

From: A novel PCR-based method for high throughput prokaryotic expression of antimicrobial peptide genes

AMPs Name Oligomer sequence (5'-3')
Hexapeptide 026 F TTAACGCCATTGCCAGCGACGGCAGCTGGTCACCCACAG
  026R CGTCGCTGGCAATGGCGTTAAAAGCTTGCGGCCGC
Combi-1 726 F TTAGAAACGCCACCAACGACGGCAGCTGGTCACCCACAG
  726R CGTCGTTGGTGGCGTTTCTAAAAGCTTGCGGCCGC
Temporin
G
099 F CAGAATGCGGCCAATGACCGGAAAAAAGCAGCTGGTCACCCACAG
  099R ATTGGCCGCATTCTGAATGGCATCCTGTAAAAGCTTGCGGCCGC
human
Histatin 9
803 F TGGCTGTGGTGTTTCTCATGGAATTTACGGCAGCTGGTCACCCACAG
  803R AGAAACACCACAGCCATCGTGGGTATCGTTAAAAGCTTGCGGCCGC
BLP-7 054-1 CTGTGGGTGACCAGCTGCGGCATTG
  054-2 GGGCGCTTTTTCCCGCGCTCAGCAGCGCGCCTCCAATGCCGCAGCTGGTC
  054-3 GCGGGAAAAAGCGCCCTGAAAGGCCTGGCGAAAGGCTTGGCGGAACATTT
  054-4 GCGGCCGCAAGCTTTTAATTCGCAAAATGTTCCGCCAAGCCTT
human
Histatin 6
801-1 CTGTGGGTGACCAGCTGC
  801-2 CTTATAGCCGTGATGACGCTTCGCATGGCTATCGCAGCTGGTCACCCACA
  801-3 AAGCGTCATCACGGCTATAAGCGCAAGTTTCACGAAAAACACCACAGCCA
  801-4 GCGGCCGCAAGCTTTTAACGATAACCACGATGGCTGTGGTGTTTTTCGT
  backbone eF TGAGATCCGGCTGCTAACAAAGCCC
  backbone eR GCAGCTGGTCACCCACAGCG