Skip to main content

Table 1 Primers for vector construction

From: A novel PCR-based method for high throughput prokaryotic expression of antimicrobial peptide genes

Primer name Sequence(5'-3')
Pf GACACAGCGAACGGCGCAGCTGGTCACCCACAGCGGGCAAT
Pr GAGCTGTACAAGTGAAAGCTTGCGGCCGCACTCGAGCAC
Gf GCCGTTCGCTGTGTCGCACAAT
Gr TCACTTGTACAGCTCGTCCATGCCAT