Skip to main content

Table 1 Oligodeoxynucleotide sequences examined in this study

From: Nuclease-resistant immunostimulatory phosphodiester CpG oligodeoxynucleotides as human Toll-like receptor 9 agonists

ODNs Sequences (5'→3')
PD-ODN2006 T CG T CG TTTTGT CG TTTTGT CG TT
PTO-ODN2006 tcgtcgttttgtcgttttgtcgtt
PTO-ODN2006-GC tgctgcttttgtgcttttgtgctt
PTO-ODN2006-1GC tgctcgttttgtcgttttgtcgtt
PTO-ODN2006-2GC tcgtgcttttgtcgttttgtcgtt
PTO-ODN2006-3GC tcgtcgttttgtgcttttgtcgtt
PTO-ODN2006-4GC tcgtcgttttgtcgttttgtgctt
PTO-ODN2006-2,3,4GC tcgtgcttttgtgcttttgtgctt
PTO-ODN2006-2,3GC tcgtgcttttgtgcttttgtcgtt
PTO-ODN2006-2,4GC tcgtgcttttgtcgttttgtgctt
PTO-ODN2006-3,4GC tcgtcgttttgtgcttttgtgctt
PD-ODN2006-3'-A T CG T CG TTTTGT CG TTTTGT CG TT-CCTTCAGTGGGACC
PD-ODN2006-5'-A CCTTCAGTGGGACC-T CG T CG TTTTGT CG TTTTGT CG TT
PD-ODN2006-3'-B T CG T CG TTTTGT CG TTTTGT CG TT-GGTCCCACTGAAGG
PD-ODN2006-5'-B GGTCCCACTGAAGG-T CG T CG TTTTGT CG TTTTGT CG TT
PD-ODN2006-3'-A-2006 T CG T CG TTTTGT CG TTTTGT CG TT-CCTTCAGTGGGACC-T CG T CG TTTTGT CG TTTTGT CG TT
PD-ODN2006-3'-B-2006 T CG T CG TTTTGT CG TTTTGT CG TT-GGTCCCACTGAAGG-T CG T CG TTTTGT CG TTTTGT CG TT
PD-ODN2006-2006 T CG T CG TTTTGT CG TTTTGT CG TT-T CG T CG TTTTGT CG TTTTGT CG TT
PD-ODN2006-TCGTCGTT T CG T CG TTTTGT CG TTTTGT CG TT-TCGTCGTT
PD-ODN2006-TCGTCGTTTTGTCGTT T CG T CG TTTTGT CG TTTTGT CG TT-TCGTCGTTTTGTCGTT
PD-ODN2006-2006-2006 T CG T CG TTTTGT CG TTTTGT CG TT-T CG T CG TTTTGT CG TTTTGT CG TT-T CG T CG TTTTGT CG TTTTGT CG TT
PD-ODN2006-G5 T CG T CG TTTTGT CG TTTTGT CG TT-GGGGG
  1. ODNs: oligodeoxynucleotides; PD: phosphodiester; PTO: phosphorothioate. Capital and lowercase letters in sequences indicate PD and PTO backbones, respectively. Bold sequences indicate the PD-ODN2006 sequence.