Skip to main content

Table 1 Wild-type and mutant template sequences, and 'bubble-forming' oligonucleotide sequences used in this study

From: Enhanced annealing of mismatched oligonucleotides using a novel melting curve assay allows efficient in vitro discrimination and restriction of a single nucleotide polymorphism

Name Oligonucleotide sequence (5' > 3')a, b
Wild-type sense template AGATTAAGAGAACCAACACCTCT
Wild-type antisense template AGAGGTGTTGGTTCTCTTAATCT
Mutant sense template AGATTAAGAGAGCCAACACCTCT
Mutant antisense template AGAGGTGTTGGCTCTCTTAATCT
1 × 1 mismatch - sense complimentary AGAGGTGTTGT TTCTCTTAATCT
1 × 1 mismatch - antisense complimentary AGATTAAGAGAA TCAACACCTCT
2 × 1 mismatch - sense complimentary AGAGGTGTTGT T GCTCTTAATCT
2 × 1 mismatch - antisense complimentary AGATTAAGAGG A TCAACACCTCT
2 × 2 mismatch - sense complimentary AGAGGTGTTAT T GTTCTTAATCT
2 × 2 mismatch - antisense complimentary AGATTAAGATG A TAAACACCTCT
  1. a Wild-type and mutant template sequences differ by a single nucleotide change, indicated in bold. Note in the 1 × 1, 2 × 1 and 2 × 2 sequences, the nucleotide at the mutation site is complementary to that of the wild-type sequence.
  2. b Induced nucleotide mismatches to generate mismatch "bubbles" in 1 × 1, 2 × 1, and 2 × 2 oligonucleotides that differ from the template sequence are indicated by being underlined.