Skip to main content

Table 4 Information for amplifying hormone and photoperiod marker genes

From: Construction of high quality Gateway™ entry libraries and their application to yeast two-hybrid for the monocot model plant Brachypodium distachyon

Photoperiod IBI# Forward primer (5'-----3') Reverse primer (5'-----3') Product (bp)
BdGI Bradi2g05230 TCTTGCGTGCAATTGGAACT AGCAACGTTGGCTGAGACAG 100
BdTOC1 Bradi3g48880 TAGTCGCTCTGACAGGAGGGCTG TAACAAACTGCCCTCTCACCCTTG 90
Hormone IBI# Forward primer (5'-----3') Reverse primer (5'-----3') Product (bp)
ABA Bradi2g22460 ACCCCAGGGCAGGTGCTCATTAAGT CTCCTCTCCGGTCAGGACACGCTTC 180
ACC Bradi1g57590 CATTACACGCAGGTGGTGTGGAGGA TAGGGGCTCTCCCCGTTGAAGTTCC 132
BL Bradi2g31700 CATCTGCGGGCAGGTGCAGGACTAC CGATGACGTGGAGGGAGTACATGATG 116
GA3 Bradi2g31760 GTGGTGGCGCAGATGTGGATCAAGG GAGAGGCTCTGCCCGTTGAGGTAGG 110
IBA Bradi2g50840 ATTGGACCGCTGGAGATCAGGGTGGTG GGCGCCTTGTACTGGTTGATGGACG 101
MeJA Bradi3g30860 CACCACCTCCAGAACACCACCCAGT GTAGCCCACGGACATGCGGATAAGC 165
KT Bradi1g64920 GGCGTGGAGGTGAAGGACGAGATCA ATGCTTCCGGATTGGCGACGAGGTA 97
SA Bradi2g05870 CTCGGTAAACGCTTCTTTCCGCGCTG ACCGGGCAAACTCCTCCTTGTCCTC 185
REF Bradi4g00660 GGAGGCACCTCAGGTCATTT ATAGCGGTCATTGTCTTGCG 193