Skip to main content

Table 1 Probe sets for genes of interest used for Nanostring analysis

From: mRNA transcript quantification in archival samples using multiplexed, color-coded probes

Gene Symbol Accession Number Target Region Target Sequence
COL3A1 NM_000090.3 180-280 TTGGCACAACAGGAAGCTGTTGAAGGAGGATGTTCCCATCTTGGTCAGTCCTATGCGGATAGAGATGTCTGGAAGCCAGAACCATGCCAAATATGTGTCT
COL4A1 NM_001845.4 780-880 TGGGCTTAAGTTTTCAAGGACCAAAAGGTGACAAGGGTGACCAAGGGGTCAGTGGGCCTCCAGGAGTAβCCAGGACAAGCTCAAGTTCAAGAAAAAGGAGA
COL5A1 NM_000093.3 6345-6445 GTAAAGGTCATCCCACCATCACCAAAGCCTCCGTTTTTAACAACCTCCAACACGATCCATTTAGAGGCCAAATGTCATTCTGCAGGTGCCTTCCCGATGG
COL5A2 NM_000393.3 4075-4175 GGTTCATGCTACCCTGAAGTCACTCAGTAGTCAGATTGAAACCATGCGCAGCCCCGATGGCTCGAAAAAGCACCCAGCCCGCACGTGTGATGACCTAAAG
CTHRC1 NM_138455.2 685-785 CTGTGGAAGGACTTTGTGAAGGAATTGGTGCTGGATTAGTGGATGTTGCTATCTGGGTTGGCACTTGTTCAGATTACCCAAAAGGAGATGCTTCTACTGG
CXCL1 NM_001511.1 445-545 AGGCCCTGCCCTTATAGGAACAGAAGAGGAAAGAGAGACACAGCTGCAGAGGCCACCTGGATTGTGCCTAATGTGTTTGAGCATCGCTTAGGAGAAGTCT
CXCL13 NM_006419.2 0-100 GAGAAGATGTTTGAAAAAACTGACTCTGCTAATGAGCCTGGACTCAGAGCTCAAGTCTGAACTCTACCTCCAGACAGAATGAAGTTCATCTCGACATCTC
MMP1 NM_002421.3 1117-1217 AAATGGGCTTGAAGCTGCTTACGAATTTGCCGACAGAGATGAAGTCCGGTTTTTCAAAGGGAATAAGTACTGGGCTGTTCAGGGACAGAATGTGCTACAC
P4HA2 NM_001017974.1 1600-1700 TGTGCTTGTGGGCTGCAAGTGGGTCTCCAATAAGTGGTTCCATGAACGAGGACAGGAGTTCTTGAGACCTTGTGGATCAACAGAAGTTGACTGACATCCT
PDPN NM_006474.4 431-531 CTCCAGGAACCAGCGAAGACCGCTATAAGTCTGGCTTGACAACTCTGGTGGCAACAAGTGTCAACAGTGTAACAGGCATTCGCATCGAGGATCTGCCAAC
PLOD2 NM_182943.2 2590-2690 AAACATTGCACTTAATAACGTGGGAGAAGACTTTCAGGGAGGTGGTTGCAAATTTCTAAGGTACAATTGCTCTATTGAGTCACCACGAAAAGGCTGGAGC
POSTN NM_001135935.1 910-1010 AGAGACGGTCACTTCACACTCTTTGCTCCCACCAATGAGGCTTTTGAGAAACTTCCACGAGGTGTCCTAGAAAGGATCATGGGAGACAAAGTGGCTTCCG
SDHA NM_004168.1 230-330 TGGAGGGGCAGGCTTGCGAGCTGCATTTGGCCTTTCTGAGGCAGGGTTTAATACAGCATGTGTTACCAAGCTGTTTCCTACCAGGTCACACACTGTTGCA
SERPINE1 NM_000602.2 2470-2570 TGTGTTCAATAGATTTAGGAGCAGAAATGCAAGGGGCTGCATGACCTACCAGGACAGAACTTTCCCCAATTACAGGGTGACTCACAGCCGCATTGGTGAC
SERPINE2 NM_006216.2 240-340 CGCTGCCTTCCATCTGCTCCCACTTCAATCCTCTGTCTCTCGAGGAACTAGGCTCCAACACGGGGATCCAGGTTTTCAATCAGATTGTGAAGTCGAGGCC
SERPINH1 NM_001235.2 880-980 ATGGTGGACAACCGTGGCTTCATGGTGACTCGGTCCTATACCGTGGGTGTCATGATGATGCACCGGACAGGCCTCTACAACTACTACGACGACGAGAAGG
THBS2 NM_003247.2 4460-4560 AAACATCCTTGCAAATGGGTGTGACGCGGTTCCAGATGTGGATTTGGCAAAACCTCATTTAAGTAAAAGGTTAGCAGAGCAAAGTGCGGTGCTTTAGCTG
TNC NM_002160.1 6885-6985 CAGAAATCTTGAAGGCAGGCGCAAACGGGCATAAATTGGAGGGACCACTGGGTGAGAGAGGAATAAGGCGGCCCAGAGCGAGGAAAGGATTTTACCAAAG
GAPDH NM_002046.3 35-135 TCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTT
RPS18 NM_022551.2 110-210 GCGGCGGAAAATAGCCTTTGCCATCACTGCCATTAAGGGTGTGGGCCGAAGATATGCTCATGTGGTGTTGAGGAAAGCAGACATTGACCTCACCAAGAGG
  1. GAPDH and RPS18 were used as internal controls for normalization of Nanostring data.