Skip to main content

Advertisement

Table 4 Oligonucleotide primer sets and PCR amplicon properties

From: 1,2-propanediol-trehalose mixture as a potent quantitative real-time PCR enhancer

No Gene* Chromosome Amplicon Primer (5'-3')
  Name No. Position (Start-End)** %GC Fragment (bp)/name Forward/reverse
Pr. 1 Thy-1 9 43854065-43854933 53.6 864/Fr. 1 ATGAACCCAGCCATCAGCG/GGGTAAGGACCTTGATATAGG
Pr. 2 NTAL 5 135085842-135086225 50.8 384/Fr. 2 CTAGGGAGCTGAGTGTTCTCA/GAACGGCTAGAACTACACAGAG
Pr. 3 NP_660313.1 16 613645-614375 71.5 731/Fr. 3 GGTCGCCGACATCCACTC/TGCTCCGGGAACAGAACCT
Pr. 4 Q8WZ58 11 2292033-2292813 71.7 781/Fr. 4 CCTGACCGTCCTGGCACA/CTGGCGAAATCTGCGAGTTC
Pr. 5 NP_060193.2 9 140174905-140175662 72.4 758/Fr. 5 CCCCTCACTCAGGTCGTGTTTT/CCCTCTGAGCCCCTTTCG
Pr. 6 Q8N4X1 16 2029023-2029774 72.6 752/Fr. 6 CGGTCCATCCCCTCATCG/ACCCCTCACGCCACCAC
Pr. 7 NP_001035158.1 16 33961629-33962363 73.1 735/Fr. 7 CGGCGAACCGGACATCC/GGCTCGTGAGGCGGGTCT
Pr. 8 Q8N1R6 13 111267817-111268622 73.3 806/Fr. 8 GACACGGCCCTGCTCC/GGGTGTGATTGAGCGAGTTG
Pr. 9 NM_020975 10 43572333-43572724 79.1 392/Fr. 9 CCCGCACTGAGCTCCTACAC/GGACGTCGCCTTCGCCATCG
  1. * Homo_sapiens LATESTGP database was used, except for Thy-1 and NTAL for which Mus_musculus LATESTGP database was used.
  2. ** Primer sets Pr. 3 - Pr. 9. are based on Ensembl release 56 - Sept 2009