Skip to main content

Table 4 A list of cancer-related genes targeted by iggyback or Tol2

From: Genome-wide target profiling of piggyBac and Tol2in HEK 293: pros and cons for gene discovery and gene therapy

Transposon Target ID Sequence Targeted Cancer Gene Annotation
piggyBac B102-2 TTAAATAAAAAAGAACAGATATTTGAAATTGGCTGTTG GPHN gephyrin
  B107-3 TTAATGATTCTTTCCATTTCTTTTATTCTTTTCCTAGC HHEX hematopoietically expressed homeobox
  B27-3 TTAATAGAAAGGAAGGGACCATGTTTAACATAAATGCT POU6F2 POU class 6 homeobox 2
  B38-4 TTAAATAAAAAAGAACAGATATTTGAAATTGGCTGTTG GPHN gephyrin
  B63-1 TTAAGTTTTCAGTGGCTGAAAGTTGGCAGTCTGAAAAA ARF4 ADP-ribosylation factor 4
  B81-1 TTAAGTGCTTTTGGCTGTTTTCCCAAACATCCAGACAT SMAD5 SMAD family member 5
Tol2 T12-2 GGTAGGAGTTATCTGAGTCAGGCCTGCCCTTGGCTTGG SPECC1 cytospin B
  T121-1 CTCCTGGGTGACCCTCGCCTGAGCCTCCTGGCCCTTCC RAB40B RAB40B, member RAS oncogene family
  T102-4 GACACAAACACACACATGCTATACCTTTGTATTACACT TCF4 transcription factor 4
  T124-4 GCGGCTGTCCTCCAGCAACAGGTGCACATTCCCGGGCT TNK1 tyrosine kinase, non-receptor
  T130-2 CAAATAAATGAATGTTATGAATTTTTGAGGGTAGGAAA SEMA3C sema domain, immunoglobulin domain (Ig), (semaphorin) 3C precursor
  T137-3 AAAGAGAGGCCCAATCCTGTGGAGTGAGTCACTGGGGG ALPL alkaline phosphatase, liver/bone/kidney
  T137-4 ATTTTCTGTCTGCTCTTTGGTCACTTCCCATTCTTTTT PARD3 par-3 partitioning defective 3 homolog (C. elegans)
  T157-4 TTTATTTGTCCTGCACTTATGAAGCATAGTTTGGCAGG PGR progesterone receptor
  T165-1 GAAACCGGCGAAAAGGTTAGCTGTCGCTGGCTAGTATT RASSF3 Ras association (RalGDS/AF-6) domain family member 3
  T22-1 TTCCTAAGCTACAATAAACCACATATGAAAAACTAAAG HD huntingtin
  T26-1 AGCCTGAGTAAAATAGTGAGACTCTGTTTCTGCAAAAC LRP1B low density lipoprotein-related protein 1B
  T43-3 TCTGGAAGGTGAGGCAGACGTGCCCACCGCCTCCATGC HLXB9 motor neuron and pancreas homeobox 1
  T91-4 TTCAGGGGGTGTGTTGGAGGGGAATCGCCGGCCTGCCT IHH Indian hedgehog homolog (Drosophila)
  TB7-5 AATTTATCCATTTCTTCTAGATTTTCTAGTTTATTCGC FKBP1A FK506 binding protein 1A, 12kDa
  TB70-1 GTGCACACACTCACTCTCTCTTTCTCCTTCAGATAATA FOXP1 forkhead box P1
  TB77-2 CCCCTCACCCTCGGACCCTTCACCGCGACCCCCGCGCC RANBP9 RAN binding protein 9
  TB81-1 TGCAGTACAGTGCGGGGGGAAAAAAACAACAGCAAAAG EGF epidermal growth factor (beta-urogastrone)