Skip to main content

Table 3 The piggyBac and Tol2 targets located within the repetitive sequences of the HEK 293 genome

From: Genome-wide target profiling of piggyBac and Tol2in HEK 293: pros and cons for gene discovery and gene therapy

Transposon Representative targets Sequence (+1 ~ +30) Position Sequence identity Types of repeats Times targeted
     100% 99.9%~97.0% Total   
piggyBac B89-4 TTAAAGACCCTGTCTCTTAAAAAAAAAAAA chr16(30140496) 4 0 4 NF 2
  B87-4 TTAAGAATGTTGAATATTGGCCCCCACTCT chr3(55059477) 1 510 511 NF 1
  B75-4 TTAAAGAAACAAGTTAACACCGAAGCCAGA chr17(60391785) 1 1 2 NF 2
  B85-4 TTAAAAAAGGCATTATTTTCGCAGCTATCT chr6(125167100) 0 2 2 NF 1
  B42-3 TTAATTTACTTAAGATAATGGCCTCCACAC chr22(15414966) 5 3 8 NF 1
  B100-1 TTAAGAAAGGAGTTGAATTAAGCTCAGGTT chr1(120900969) 0 2 2 NF 1
  B90-1 TTAATATCCCACCTTTGCACAGTAGACAAT chr3(137392502) 2 0 2 NF 1
  B92-2 TTAAACACACACTTAGAGGGAAATAATTCAT chr18(11877795) 0 2 2 NF 1
  B82-3 TAAAGAATATAAGGCCAAGCACAGTGGCT chr11(27402368) 1 1 2 NF 1
  B89-3 TTAAATAAAGATAATAATACTAACCATGGC chr3(57972969) 1 1 2 NF 1
  B92-1 TTAAAGAAACAAGTTAACACCGAAGCCAGA chr17(60391785) 2 2 4 NF 1
  B77-4 TTAAAGACCCTGTCTCTTAAAAAAAAAAAA chr16(29401156) 0 4 4 NF 1
  B79-2 TTAAGGGGGGAAAACAGTTCAGGGCCAACA chr14(55711916) 1 1 2 NF 1
  B84-1 TTAATGTTAAATTACAAACACTGTTTTATC chr18(29434150) 0 2 2 NF 1
  B85-1 TTAAGCACAGTATCAGTGATAAAAATAGCT chr1(201276407) 1 1 2 NF 1
  B82-1 TTAAGCTGAATCTGTTTTTCCCAGTGCCCC chr2(231461932) 0 2 2 NF 1
Tol2 T111-3 TTTAAGAATGTTGAGTATTGGCCCCCACTC chr8(9712455) 1 8 9 LINE 1
  T147-1 ATCCTGAGCAGCCGAATCTGCAATCATCTT chr7(154665283) 1 1 2 LTR 1
  T3-2 TCCACCACAGCATGAGTTAAACCAAAGTCT chr7(76097237) 2 0 2 LINE 1
  T88-3 GTCTGTACTGCTGCAAAGCTTCACAGACAG chr10(98485313) 1 2 3 NF 1
  T115-4 AATTTATCCATTTCTTCTAGATTTTCTAGT chr20(1472025) 0 3 3 LINE 4
  T103-2 GGCGCCCGCCACTACGCCTGGCTAATTTTT chr21(13847935) 1 3 4 SINE 1
  T162-3 CCAGAGACCTTTGTTCACTTGTTTATCTGC chr20(33206406) 202 ND > 202 Low_complexity 1
  T157-1 CTCGTACGTAAGTTTTAGTGTGAACATATA chr4(48956277) 4 3 7 LINE 1
  T157-2 GTTAACAGTGACCTATTTGGGAGAAGGGGA chr7(66290199) 1 1 2 LINE 1
  T107-2 AATATATGAGTAGCTAAACAACTCTATAAG chr2(97613844) 1 1 2 LINE 1
  T104-1 GAACACATGGACACAGGAAGGGGAACATCA chr3(134171282) 1 52 53 LINE 1
  T25-3 ACCCCATCTCTACTAAAAATACAAAAAATT chr6(166733349) 1 1 2 SINE 1