Skip to main content

Table 2 The piggyBac and Tol2 hotspots in the HEK 293 genome

From: Genome-wide target profiling of piggyBac and Tol2in HEK 293: pros and cons for gene discovery and gene therapy

Transposon Target ID Targeted sequence Times Position Gene context Targeted Gene Near gene (distance bp) Far gene (distance bp)
piggyBac B87-5/B89-3 TTAAATAAAGATAATAATACTAACCATGGCA 2 3p14.3 INTRONIC FLNB   
  B89-4/B77-4 TTAAAGACCCTGTCTCTTAAAAAAAAAAAAA 2 16p11.2 3'UTR MLAS   
  B38-4/B102-2 TTAAATAAAAAAGAACAGATATTTGAAATTG 2 14q23.3 INTRONIC GPHN   
  B71-1/B109-3 TTAAATTCCAGGTTTCTCAAAGAAAGCTTGT 2 20p12.3 INTERGENIC   BC043288(219296) BMP2 (347908)
  B75-4/B92-1 TTAAAGAAACAAGTTAACACCGAAGCCAGAG 2 17q24.1 INTERGENIC   FLJ32065 (2686) LRRC37A3 (101620)
Tol2 T47-2/T48-3 TGTTCCGCTCCTGGTGCGGGCCGAGACCCGG 2 1q21.2 INTRONIC ZNF687   
  111-2/T119-1 TATGTGTAATAATGGAGGTATGTACAACAT 2 3p24.3 INTERGENIC   SGOL1 (385347) HPX-42 (834010)
  T14-3/T17-1 AGAATAGGTATTTCTTTTTTTCTTCTTATC 2 5q33.2 INTERGENIC   C5orf3 (87465) GRIA1 (92385)
  T2-1/T3-2 TCCACCACAGCATGAGTTAAACCAAAGTCT 2 7q11.23 INTERGENIC   POMZP3 (2680) hPMSR6 (350693)
  T1-3/T4-1 CCTGCCCAGCTCGTAAAAGGATGCTCACCT 2 8q22.3 INTERGENIC   GRHL2 (694) NACAP1 (122197)
  TB7-3/T113-1/T115-4/T120-2 AATTTATCCATTTCTTCTAGATTTTCTAGT 2 20p13 INTRONIC SIRPD