Skip to main content

Table 2 Primers used in the PCR amplification to obtain the optimized SAG1(77-322) sequence.

From: Effect of codon optimization and subcellular targeting on Toxoplasma gondii antigen SAG1 expression in tobacco leaves to use in subcutaneous and oral immunization in mice

Primer name Length Sequences
AC 26 bp 5' atcgatatgggcaacttgagatcttc 3'
ERV 39 bp 5' gatatcTCAcatAgcaaaGatAgaaacAtgaGAAgctgt 3'
SK 57 bp 5' cccgggtcatagctcatctttctcagacatAgcaaaGatAgaaacAtgaGAAgctgt3'
F1 36 bp 5' tactcaccAaacagAcaaatctgTccagcTggtact 3'
R1 54 bp 5' TctgttTggtgagtaAgcaagagtTggaggTtctgtAagAgctgtCttaggAca 3'
F3 30 bp 5' acaacTcaAacAtttgtTgtTggttgcatc 3'
R3 30 bp 5' aaaTgtTtgAgttgtAacTggAaacttctc 3'
F4 33 bp 5' caagcTagagcctcatcTgtTgtcaaCaatgtc 3'
R4 33 bp 5' AgatgaggctctAgcttgAactgtcacTgtgac 3'
F5 39 bp 5' ggaccAactacaatgacTctTgtTtgTggTaaagatgga 3'
R5 36 bp 5' AagAgtcattgtagtTggtccttcAgcagacaactt 3'
F7 48 bp 5' gtTatCattggatgTacaggTggatcTcctgagaagcatcactgtacT 3'
R7 39 bp 5' AcatccaatGatAacActCttAgaTtcAgctggaaatgc 3'
F8 48 bp 5' ggAgctgcaggAtcagcTaaGtcTgctgcAggaacagcTTCtcaTgtttcT 3'
R8 48 bp 5' tgaTcctgcagcTccAgcaaactcAagtttcacAgtacagtgatgctt 3'
  1. Recognition site for the endonuclease ClaI, EcoRV and SmaI indicated underlined in AC, ERV and SK primers, respectively. Specific mutation sites are indicated in capital letters.