Skip to main content

Table 2 Primers used in TNCL virus study

From: Ao38, a new cell line from eggs of the black witch moth, Ascalapha odorata (Lepidoptera: Noctuidae), is permissive for AcMNPV infection and produces high levels of recombinant proteins

Primer Sequence (5'-3') TNCL RNA segment Position on viral genome* Direction
Noda-R1-190F gggaaccgagttacacgcgcattgc 1 190..214 >
Noda-R1-636R ggtgaatggtgagtcagcatc 1 616..636 <
Noda-R1-1093F caatctgtcaacgctaggcttatcgg 1 1093..1188 >
Noda-R1-1531R ccgccctaagttgtagttgttgggacgg 1 1504..1531 <
Noda-R1-2368F tgtaccgatgcgcttactccgttgatatcgg 1 2368..2398 >
Noda-R1-2933R ccacgctgggtttctccagcagtgatgttacc 1 2902..2933 <
Noda-R2-269F ggaatacctgatagatttgaaggcaaag 2 269..296 >
Noda-R2-810R ggcaatgtttggataccctccaatatgtcg 2 781..810 <
Noda-D4 acatccagatccgatcaagt 2 491..510 >
Noda-U4 gccaggaatgttgcttgcaa 2 1161..1180 <
Primer Sequence (5'-3') gp64 Position* direction
C-177Fs attttggacgctgagggc   109139..109156 <
L-330Rs cttgttgatgtgcgcatgcatcagctc   108731..108757 >
  1. *; position of each primer is based on sequences of deposited in GenBank under accession numbers EF690537 (TNCL virus RNA1), EF690538 (TNCL virus RNA2), and L22858 (AcMNPV)