Skip to main content

Table 1 Oligonucleotide sequences

From: Escherichia coli MW005: lambda Red-mediated recombineering and copy-number induction of oriV-equipped constructs in a single host

No Sequence (5'-3')a
6075 CTAGCGTTTGCAATGCACCAGGTC
6076 GACGCTTTTTATCGCAACTCTCTAC
6088 ctctactgtttctccatacccgttttttgggctaacaggaggaattaaccATGAATCGGACGTTTGACCGGAAG
6089 atctgtatcaggctgaaaatcttctctcatccgccaaaacagccaagcttCTAGCGTTTGCAATGCACCAGGTC
6090 ctctactgtttctccatacccgttttttgggctaacaggaggaattaaccTCGCTGTCGAGATATGACGGTG
6091 atctgtatcaggctgaaaatcttctctcatccgccaaaacagccaagcttGATGATAAGCTGTCAAACATGAG
6102 CACCGTGCGTGTTGACTATTTTACC
6103 ACGATGTGCGCGTACTGGGGGC
S0316 aaaacaaacgttgcccatcttcaactccaattcaatcaacttcctcttctATGAGTAAAGGAGAAGAACT
S0317 ttgattaagaatttattaagtaaaagtgatcaaatataaaaagattatcaTTTGTATAGTTCATCCATGC
S0015 GAGTAACTCGGCTGTCGGCTGTCGG
S0016 AATGGGAAGTATTCGGACGGGCGGAG
  1. aHomology arm and PCR template annealing sequences given in lower and upper case, respectively
\