Skip to main content

Table 3 Sequences of used promoters and primers

From: Promoter knock-in: a novel rational method for the fine tuning of genes

Primer Sequence
Fw-EcoRI-p37 gggggaattccttacatgaaaaaggttcttg
Rv-BamHI-p37 ttttggatcccatctttgtttcctccgagaaaaatgacatataccacatgg
Fw-EcoRI-p55 gggggaattccttagaaggaatttgttcttg
Rv-BamHI-p55 ttttggatcccatctttgtttcctccgagatacctaaaaattatacc
Fw-EcoRI-P1 ttttgaattcgtgtaggctggagctgcttc
Rv-HindIII-P2 ggggaagcttcatatgaatatcctccttag
Fw-ppc-HIS-RBS-37 acattactacgcaatgcggaatattgttcgttgtggtgatggtgatggtgcgccatctttgtttcctccgagaaaaatgac
Fw-ppc-HIS-RBS-55 acattactacgcaatgcggaatattgttcgttgtggtgatggtgatggtgcgccatctttgtttcctccgagatacctaa
Rv-ppc-P2 cgtgaaggatacagggctatcaaacgataagatggggtgtctggggtaatcatatgaatatcctccttag
Rv-ppc-3-P2 atcaagcccacccgcgaactgataacccaggtaattcaccatttttgctggcattaacatatgaatatcctccttag
Fw-ppc-37 tccttcacgtcgcattggcgcgaatatgctcgggctttgcttttcgtcgtcaaaaatgacatataccacatgga
Fw-ppc-55 tttgccgagcatactgacattactacgcaatgcggaatattgttcgttcatctttgtttcctccgagatacctaaaaattataccacatcaac