Skip to main content

Table 3 List of forward and reverse primers used for semi-quantitative RT-PCR.

From: Yeast functional screen to identify genetic determinants capable of conferring abiotic stress tolerance in Jatropha curcas

Name of Gene* Forward primer Reverse primer
LEA-5 5' ATGGCTCGCCCTTTCTCAAACG 3' 5' TCAGTTTTTCTTCAGAAGCATAGCTCTTAATTCGG 3'
Apx-1 5'ATGGCTAAGAACTATCCAAAAGTAAGC
GAAGAGTA3'
5' TTAGGCATCAGCAAATCCCAGCTCTG3'
Metallothionein 5' ATGTCTTGCTGCGGAGGAAACTG 3' 5' CACACGACAGGGTTTGAGAAGGTAC 3'
Profilin 5' ATGTCGTGGCAAACATACGTAGATGAGC 3' 5' CCAAGCCTTTCGACAATCATGTTGC 3'
Annexin 5' ATGGCTACCATTGTTGTTCCTGCC 3' 5' AGCTGTGTCTTGCTCCTTGTAGTGAG 3'
  1. *LEA-5, late embryogenesis abundant protein-5; Apx-1, cytosolic ascorbate peroxidase -1.