Skip to main content

Advertisement

Table 1 Oligonucleotides used in this work

From: A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering

Oligonucleotide Sequence (5'-3')
Cre1YILY-1UF ATTGGTTTCdUTGGTGTATATACTGTATGGTGGTGCAGCTATGCACATAGTAAAAGTCGAAGATGATTT
Cre1YILY-1UR AGAAACCAAdUCGCAAAGAACAATGG
Cre1YILY-1XF PO4TGGTGTATATACTGTATGGTGGTGCAGCTATGCACATAGTAAAAGTCGAAGATGATTT
Cre1YILY-1XR PO4-AGAAACCAATCGCAAAGAACAATGG
Pfu-V93Q-F GTGGAAACTTTATTTGGAACATCCCCAAGATCAGCCCACTATTAGAGAAAAAGT
Pfu-V93Q-R ACTTTTTCTCTAATAGTGGGCTGATCTTGGGGATGTTCCAAATAAAGTTTCCAC
Pfu-upstream-F GCGTTACTGCCTGGGGAAGA
Pfu-R ACCGCCGGdUACCGGATTTTTTAATGTTAAGCCAGGAAG
Pfu-F AGCAGAAAAAGdUAGCAATTCGTCGTGCATCTGTTTG
Pfu-downstream-R GGCCCCAAGGGGTTATGCTA
Sso7d-1F ACCGGCGGdUGGCGGTGCAACCGTAAAGTTCAAGTACAAAGGCGAAGAAAAAGAGGTAGACATCTCCAAGATCAAGAAAGT
Sso7d-1R ACTTTCTTGAdUCTTGGAGATGTCTACCTCTTTTTCTTCGCCTTTGTACTTGAACTTTACGGTTGCACCGCCACCGCCGGT
Sso7d-2F ATCAAGAAAGdUATGGCGTGTGGGCAAGATGATCTCCTTCACCTACGACGAGGGCGGTGGCAAGACCGGCCGT
Sso7d-2R ACGGCCGGTCdUTGCCACCGCCCTCGTCGTAGGTGAAGGAGATCATCTTGCCCACACGCCATACTTTCTTGAT
Sso7d-3F AGACCGGCCGdUGGTGCGGTAAGCGAAAAGGACGCGCCGAAGGAGCTGCTGCAGATGCTGGAGAAGCAGAAAAAGT
Sso7d-3R ACTTTTTCTGCdUTCTCCAGCATCTGCAGCAGCTCCTTCGGCGCGTCCTTTTCGCTTACCGCACCACGGCCGGTCT
GFP-Y40STOP-F GGGTGAAGGTGATGCTACATAAGGAAAGCTTACC
GFP-Y40STOP-R GGTAAGCTTTCCTTATGTAGCATCACCTTCACCC