Skip to main content

Table 5 Oligonucleotides used to quantify gene transcripts

From: Functional genomics tool: Gene silencing in Ixodes scapularis eggs and nymphs by electroporated dsRNA

Gene Forward Primer (5'-3') Reverse Primer(5'-3') Product size (bp)
Cytosplasmic Cystatin TACTTCATCAAGGTTCGCGTTGGC TGGTGAGCGGAGAAAGTAACCTCT 92
PLA2 TATTGCAAGGCGCTTCACCGAAAG AAACACTTCAGCCAGCTTGTGACC 97
Calreticulin ATCATGCGGATCGTGTGCTTGTTG TCGCTTCCCTTCTTTGTGGAGTGT 137
Syntaxin-5 GTTTGCGGTGCTCATCGTGTTCTT ATACAGCCCAGAGCAGTCTTGTCA 93
β-Actin ACATGCTATCGTGGGTGACGAAGT TGTGGTGCCAGATCTTCTCCATGT 118
NaK ATPase TGTTGTTCATCTTGGCCGATGTGC ATGTCGCTCTCGGCAGTTTCGTAT 121
Cyclophilin A GCTTCGGTTACAAGGGCAGCAGCATTT TCCGGTGTGCTTCAGGATGAAGTT 149