Skip to main content

Table I Useful PCR primers

From: Mutant loxP vectors for selectable marker recycle and conditional knock-outs

Primer (vector) Length Sequence
NE2 (pMloxNeo) 30 mer GGCTGACCGCTTCCTCGTGCTTTACGGTAT
PU4 (pMloxPuro) 29 mer CAGCGCCCGACCGAAAGGAGCGCACGACC
BS1 (pMloxBsr) 33 mer CGATTGAAGAACTCATTCCACTCAAATATACCC
forward (pExpress) 30 mer TTATTGTGCTGTCTCATCATTTTGGCAAAG
reverse (pExpress) 30 mer CTCTACAAATGTGGTATGGCTGATTATGAT